Nazwy mutacji CFTR – lista

0

Lista patogennych mutacji CFTR powstała na podstawie bazy CFTR2 i została uzupełniona o dodatkowe dane zebrane w Polsce.

Uwaga! Lista ma charakter poglądowy i nie służy do leczenia, stawiania diagnozy czy dobierania leków.
Nazwa mutacji Nazwa wariantu cDNA Nazwa wariantu białka Inne nazwy mutacji
1078delT c.948delT p.Phe316LeufsX12
1119delA c.987delA p.Gly330GlufsX39
1138insG c.1006_1007insG p.Ile336SerfsX28
1154insTC c.1021_1022dupTC p.Phe342HisfsX28
1161delC c.1029delC p.Cys343X
1213delT c.1081delT p.Trp361GlyfsX8
1248+1G->A c.1116+1G>A
1249-1G->A c.1117-1G>A
124del23bp c.-9_14del23
1259insA c.1130dupA p.Gln378AlafsX4
1288insTA c.1155_1156dupTA p.Asn386IlefsX3
1341+1G->A c.1209+1G>A
1343delG c.1211delG p.Gly404AspfsX38
1429del7 c.1301_1307delCACTTCT p.Ser434LeufsX6
1461ins4 c.1327_1330dupGATA p.Ile444ArgfsX3
1471delA c.1340delA p.Lys447ArgfsX2
1497delGG c.1365_1366delGG p.Val456CysfsX25
1504delG c.1373delG p.Gly458AspfsX11
1525-1G->A c.1393-1G>A
1525-2A->G c.1393-2A>G
1548delG c.1418delG p.Gly473GlufsX54
1609delCA c.1477_1478delCA p.Gln493ValfsX10
1677delTA c.1545_1546delTA p.Tyr515X
1716+1G->A c.1584+1G>A
1717-1G->A c.1585-1G>A
1717-8G->A c.1585-8G>A
1782delA c.1650delA p.Gly551ValfsX8
1802delC c.1670delC p.Ser557PhefsX2
1811+1634A->G or 1811+1.6kbA->G c.1680-886A>G
1811+1643G->T c.1680-877G>T
1811+1G->A c.1679+1G>A
1811+1G->C c.1679+1G>C
1812-1G->A c.1680-1G>A
1824delA c.1692delA p.Asp565MetfsX7
182delT c.50delT p.Phe17SerfsX8
1833delT c.1703delT p.Leu568CysfsX4
185+1G->T c.53+1G>T
1898+1G->A c.1766+1G>A
1898+1G->C c.1766+1G>C
1898+1G->T c.1766+1G>T
1898+3A->G c.1766+3A>G
1898+5G->T c.1766+5G>T
1924del7 c.1792_1798delAAAACTA p.Lys598GlyfsX11
2055del9->A c.1923_1931del9insA p.Ser641ArgfsX5
2075delA c.1943delA p.Asp648ValfsX15
2105-2117del13insAGAAA c.1973_1985del13insAGAAA p.Arg658LysfsX4
2118del4 c.1986_1989delAACT p.Thr663ArgfsX8
2143delT c.2012delT p.Leu671X
2183AA->G c.2051_2052delAAinsG p.Lys684SerfsX38
2184delA c.2052delA p.Lys684AsnfsX38
2184insA c.2052dupA p.Gln685ThrfsX4
2185insC c.2053dupC p.Gln685ProfsX84
2307insA c.2175dupA p.Glu726ArgfsX4
2347delG c.2215delG p.Val739TyrfsX16
2372del8 c.2241_2248delGATACTGC p.Ile748SerfsX28
2556insAT c.2423_2424dupAT p.Ser809IlefsX13
2585delT c.2453delT p.Leu818TrpfsX3
2594delGT c.2463_2464delTG p.Ser821ArgfsX4
2622+1G->A c.2490+1G>A
2711delT c.2583delT p.Phe861LeufsX3
2721del11 c.2589_2599delAATTTGGTGCT p.Ile864SerfsX28
2732insA c.2601dupA p.Val868SerfsX28
2789+5G->A c.2657+5G>A
2790-1G->C c.2658-1G>C
2869insG c.2737_2738insG p.Tyr913X
2896insAG c.2763_2764dupAG p.Val922GlufsX2
2942insT c.2810dupT p.Val938GlyfsX37
2957delT c.2825delT p.Ile942ThrfsX26
296+1G->A c.164+1G>A
296+1G->T c.164+1G>T
296+2T->C c.164+2T>C
296+3insT c.164+3_164+4insT
297-1G->A c.165-1G>A
2991del32 c.2859_2890delACATTCTGTTCTTCAAGCACCTATGTCAACCC p.Leu953PhefsX11
3007delG c.2875delG p.Ala959HisfsX9
3028delA c.2896delA p.Thr966ArgfsX2
306delTAGA c.174_177delTAGA p.Asp58GlufsX32
306insA c.175dupA p.Arg59LysfsX10
3120+1G->A c.2988+1G>A
3120G->A c.2988G>A
3121-1G->A c.2989-1G>A
3121-2A->G c.2989-2A>G
3121-977_3499+248del2515 c.2989-977_3367+248del
3132delTG c.3002_3003delTG p.Val1001AspfsX45
3143del9 c.3011_3019delCTATAGCAG or c.3009_3017delAGCTATAGC p.Ala1004_Ala1006del
3171delC c.3039delC p.Tyr1014ThrfsX9
3171insC c.3039dupC p.Tyr1014LeufsX33
3271delGG c.3139_3139+1delGG p.Gly1047GlnfsX28
3272-26A->G c.3140-26A>G
3349insT c.3217dupT p.Tyr1073LeufsX3
3500-2A->G c.3368-2A>G
3600+2insT c.3468+2dupT
3600+5G->A c.3468+5G>A
3600G->A c.3468G>A
365-366insT c.233dupT p.Trp79LeufsX32
3659delC c.3528delC p.Lys1177SerfsX15
3667ins4 c.3532_3535dupTCAA p.Thr1179IlefsX17
3737delA c.3605delA p.Asp1202AlafsX9
3791delC c.3659delC p.Thr1220LysfsX8
3821delT c.3691delT p.Ser1231ProfsX4
3849+10kbC->T c.3718-2477C>T
3849+40A->G c.3717+40A>G
3849+4A->G c.3717+4A>G
3849+5G->A c.3717+5G>A
3849G->A c.3717G>A
3850-1G->A c.3718-1G>A
3850-3T->G c.3718-3T>G
3876delA c.3744delA p.Lys1250ArgfsX9
3878delG c.3747delG p.Lys1250ArgfsX9
3905insT c.3773dupT p.Leu1258PhefsX7
394delTT c.262_263delTT p.Leu88IlefsX22
4005+1G->A c.3873+1G>A
4005+2T->C c.3873+2T>C
4010del4 c.3883_3886delATTT p.Ile1295PhefsX32
4015delA c.3883delA p.Ile1295PhefsX33
4016insT c.3889dupT p.Ser1297PhefsX5
4022insT c.3891dupT p.Gly1298TrpfsX4
4040delA c.3908delA p.Asn1303ThrfsX25
405+1G->A c.273+1G>A
405+3A->C c.273+3A>C
406-1G->A c.274-1G>A
406-2A->G c.274-2A>G
4168delCTAAGCC c.4036_4042del p.Leu1346MetfsX6
4209TGTT->AA c.4077_4080delTGTTinsAA
4218insT c.4086dupT p.Lys1363X
4259del5 c.4127_4131delTGGAT p.Leu1376SerfsX8
4279insA c.4147dupA p.Ile1383AsnfsX3
4326delTC c.4197_4198delCT p.Cys1400X
4374+1G->A c.4242+1G>A
4374+1G->T c.4242+1G>T
4382delA c.4251delA p.Glu1418ArgfsX14
4428insGA c.4300_4301dup p.Ser1435GlyfsX14
442delA c.310delA p.Arg104GlufsX3
444delA c.313delA p.Ile105SerfsX2
457TAT->G c.325_327delTATinsG p.Tyr109GlyfsX4
541delC c.409delC p.Leu137SerfsX16
557delT c.429delT p.Phe143LeufsX10
574delA c.442delA p.Ile148LeufsX5
602del14 c.470_483delTTAGTTTGATTTAT p.Phe157X
621+1G->T c.489+1G>T
663delT c.531delT p.Ile177MetfsX12
675del4 c.543_546delTAGT p.Leu183PhefsX5
711+1G->T c.579+1G>T
711+3A->G c.579+3A>G
711+5G->A c.579+5G>A
712-1G->T c.580-1G>T
849delG c.717delG p.Leu240X
852del22 c.722_743delGGAGAATGATGATGAAGTACAG p.Gly241GlufsX13
935delA c.803delA p.Asn268IlefsX17
977insA c.850dupA p.Met284AsnfsX3
991del5 c.861_865delCTTAA p.Asn287LysfsX19
A1006E c.3017C>A p.Ala1006Glu
A455E c.1364C>A p.Ala455Glu
A46D c.137C>A p.Ala46Asp
A559T c.1675G>A p.Ala559Thr
A561E c.1682C>A p.Ala561Glu
A613T c.1837G>A p.Ala613Thr
C276X c.828C>A p.Cys276X
C524X c.1572C>A p.Cys524X
CFTR50kbdel c.(273+1_274-1)_(1116+1_1117-1)del(1584+1_1585-1)_(3468+1_3469-1)del
CFTRdele1 c.(?_1)_(53+1_54-1)del p.Glu2GlyfsX17
CFTRdele11 c.(1584+1_1585-1)_(1679+1_1680-1)del
CFTRdele13,14a c.(1766+1_1767-1)_(2619+1_2620-1)del
CFTRdele14b-17b c.(2619+1_2620-1)_(3367+1_3368-1)del
CFTRdele16-17b c.(2908+1_2909-1)_(3367+1_3368-1)del
CFTRdele17a,17b c.(2988+1_2989-1)_(3367+1_3368-1)del
CFTRdele17a-18 c.(2988+1_2989-1)_(3468+1_3469-1)del
CFTRdele18 c.(3367+1+3368-1)_(3468+1_3469-1)del
CFTRdele19 c.(3468+1_3469-1)_(3717+1_3718-1)del
CFTRdele19-21 c.(3468+1_3469-1)_(3963+1_3964-1)del
CFTRdele2 c.(53+1_54-1)_(164+1_165-1)del
CFTRdele2,3 c.54-5940_273+10250del21kb p.Ser18ArgfsX16 dele2,3(21kb)
CFTRdele21 c.(3873+1_3874-1)_(3963+1_3964-1)del
CFTRdele22,23 c.3964-78_4242+577del
CFTRdele22-24 c.(3963+1_3964-1)_(*1_?)del
CFTRdele2-4 c.(53+1_54-1)_(489+1_490-1)del
CFTRdele3-10,14b-16 c.(164+1_165-1)_(1584_+1_1585-1)del(2619+1_2620-1)_(2988+1_2989-1)del
CFTRdele4-11 c.(273+1_274-1)_(1679+1_1680-1)del
CFTRdele4-7 c.(273+1_274-1)_(1116+1_1117-1)del
CFTRdup6b-10 c.(743+1_744-1)_(1584+1_1585-1)dup
D110H c.328G>C p.Asp110His
D1152H c.3454G>C p.Asp1152His
D192G c.575A>G p.Asp192Gly
D513G c.1538A>G p.Asp513Gly
D979V c.2936A>T p.Asp979Val
E1104X c.3310G>T p.Glu1104X
E1371X c.4111G>T p.Glu1371X
E193K c.577G>A p.Glu193Lys
E193X c.577G>T p.Glu193X
E379X c.1135G>T p.Glu379X
E474K c.1420G>A p.Glu474Lys
E56K c.166G>A p.Glu56Lys
E585X c.1753G>T p.Glu585X
E60K c.178G>A p.Glu60Lys
E60X c.178G>T p.Glu60X
E656X c.1966G>T p.Glu656X
E664X c.1990G>T p.Glu664X
E822X c.2464G>T p.Glu822X
E831X c.2491G>T p.Glu831X
E92K c.274G>A p.Glu92Lys
E92X c.274G>T p.Glu92X
F191V c.571T>G p.Phe191Val
F311L c.933C>G p.Phe311Leu
F508C;S1251N c.[1523T>G;3752G>A] p.[Phe508Cys;Ser1251Asn]
F508del c.1521_1523delCTT p.Phe508del ΔF508, delta F508, 1653delCTT, f508∆
F508del;I1027T c.[1521_1523delCTT;3080T>C] p.[Phe508del;Ile1027Thr]
G1061R c.3181G>C p.Gly1061Arg
G1244E c.3731G>A p.Gly1244Glu
G1249R c.3745G>A p.Gly1249Arg
G126D c.377G>A p.Gly126D
G1349D c.4046G>A p.Gly1349Asp
G178R c.532G>A p.Gly178Arg
G194R c.580G>A p.Gly194Arg
G27R c.79G>A p.Gly27Arg
G27X c.79G>T p.Gly27X
G330X c.988G>T p.Gly330X
G542X c.1624G>T p.Gly542X
G550X c.1648G>T p.Gly550X
G551D c.1652G>A p.Gly551Asp
G551S c.1651G>A p.Gly551Ser
G628R c.1882G>C or c.1882G>A p.Gly628Arg
G673X c.2017G>T p.Gly673X
G745X c.2233G>T p.Gly745X
G85E c.254G>A p.Gly85Glu
G91R c.271G>A p.Gly91Arg
G970D c.2909G>A p.Gly970Asp
G970R c.2908G>C p.Gly970Arg
H1054D c.3160C>G p.His1054Asp
H1375P c.4124A>C p.His1375Pro
H139R c.416A>G p.His139Arg
H199Y c.595C>T p.His199Tyr
H609R c.1826A>G p.His609Arg
I1234V c.3700A>G p.Ile1234Val
I1269N c.3806T>A p.Ile1269Asn
I1366N c.4097T>A p.Ile1366Asn
I336K c.1007T>A p.Ile336Lys
I502T c.1505T>C p.Ile502Thr
I507del c.1519_1521delATC p.Ile507del
I601F c.1801A>T p.Ile601Phe
K710X c.2128A>T p.Lys710X
L102R c.305T>G p.Leu102Arg
L1065P c.3194T>C p.Leu1065Pro
L1077P c.3230T>C p.Leu1077Pro
L1254X c.3761T>G p.Leu1254X
L1324P c.3971T>C p.Leu1324Pro
L1335P c.4004T>C p.Leu1335Pro
L138ins c.413_415dupTAC p.Leu138dup
L15P c.44T>C p.Leu15Pro
L165S c.494T>C p.Leu165Ser
L206W c.617T>G p.Leu206Trp
L227R c.680T>G p.Leu227Arg
L346P c.1037T>C p.Leu346Pro
L453S c.1358T>C p.Leu453Ser
L467P c.1400T>C p.Leu467Pro
L558S c.1673T>C p.Leu558Ser
L732X c.2195T>G p.Leu732X
L88X c.263T>A or c.263T>G p.Leu88X
L927P c.2780T>C p.Leu927Pro
M1101K c.3302T>A p.Met1101Lys
M1101R c.3302T>G p.Met1101Arg
M1V c.1A>G p.Met1Val
N1303K c.3909C>G p.Asn1303Lys
P205S c.613C>T p.Pro205Ser
P574H c.1721C>A p.Pro574His
P67L c.200C>T p.Pro67Leu
P99L c.296C>T p.Pro99Leu
Q1042X c.3124C>T p.Gln1042X
Q1313X c.3937C>T p.Gln1313X
Q1330X c.3988C>T p.Gln1330X
Q1382X c.4144C>T p.Gln1382X
Q1411X c.4231C>T p.Gln1411X
Q1412X c.4234C>T p.Gln1412X
Q220X c.658C>T p.Gln220X
Q2X c.4C>T p.Gln2X
Q30X c.88C>T p.Gln30X
Q359K/T360K c.[1075C>A;1079C>A] p.[Gln359Lys;Thr360Lys]
Q39X c.115C>T p.Gln39X
Q414X c.1240C>T p.Gln414X
Q493X c.1477C>T p.Gln493X
Q525X c.1573C>T p.Gln525X
Q552X c.1654C>T p.Gln552X
Q685X c.2053C>T p.Gln685X
Q715X c.2143C>T p.Gln715X
Q720X c.2158C>T p.Gln720X
Q890X c.2668C>T p.Gln890X
Q98R c.293A>G p.Gln98Arg
Q98X c.292C>T p.Gln98X
R1066C c.3196C>T p.Arg1066Cys
R1066H c.3197G>A p.Arg1066His
R1102X c.3304A>T p.Arg1102X
R1158X c.3472C>T p.Arg1158X
R1162X c.3484C>T p.Arg1162X
R117C c.349C>T p.Arg117Cys
R117H;5T c.[350G>A;1210−12T[5]] p[.Arg117His;]
R117P c.350G>C p.Arg117Pro
R1283M c.3848G>T p.Arg1283Met
R334L c.1001G>T p.Arg334Leu
R334W c.1000C>T p.Arg334Trp
R347H c.1040G>A p.Arg347His
R347P c.1040G>C p.Arg347Pro
R352Q c.1055G>A p.Arg352Gln
R553X c.1657C>T p.Arg553X
R560K c.1679G>A p.Arg560Lys
R560S c.1680A>C p.Arg560Ser
R560T c.1679G>C p.Arg560Thr
R709X c.2125C>T p.Arg709X
R75X c.223C>T p.Arg75X
R764X c.2290C>T p.Arg764X
R785X c.2353C>T p.Arg785X
R792X c.2374C>T p.Arg792X
R851X c.2551C>T p.Arg851X
S1118F c.3353C>T p.Ser1118Phe
S1159F c.3476C>T p.Ser1159Phe
S1159P c.3475T>C p.Ser1159Pro
S1196X c.3587C>G p.Ser1196X
S1251N c.3752G>A p.Ser1251Asn
S1255P c.3763T>C p.Ser1255Pro
S1255X c.3764C>A p.Ser1255X
S13F c.38C>T p.Ser13Phe
S341P c.1021T>C p.Ser341Pro
S434X c.1301C>A or c.1301C>G p.Ser434X
S466X c.1397C>A or c.1397C>G p.Ser466X
S466X;R1070Q c.[1397C>G;3209G>A] p.[Ser466X;Arg1070Gln]
S489X c.1466C>A p.Ser489X
S492F c.1475C>T p.Ser492Phe
S4X c.11C>A p.Ser4X
S549N c.1646G>A p.Ser549Asn
S549R c.1645A>C or c.1647T>G or c.1647T>A p.Ser549Arg
S912X c.2735C>A p.Ser912X
S945L c.2834C>T p.Ser945Leu
T1036N c.3107C>A p.Thr1036Asn
T338I c.1013C>T p.Thr338Ile
V1240G c.3719T>G p.Val1240Gly
V232D c.695T>A p.Val232Asp
V456A c.1367T>C p.Val456Ala
V520F c.1558G>T p.Val520Phe
W1089X c.3266G>A p.Trp1089X
W1098C c.3294G>C or c.3294G>T p.Trp1098Cys
W1098R c.3292T>C p.Trp1098Arg
W1098X c.3293G>A or c.3294G>A p.Trp1098X
W1145X c.3435G>A p.Trp1145X
W1204X c.3611G>A or c.3612G>A p.Trp1204X
W1282X c.3846G>A p.Trp1282X
W1282X;R1283M c.[3846G>A;3848G>T] p.[Trp1282X;Arg1283Met]
W19X c.57G>A p.Trp19X
W216X c.647G>A p.Trp216X
W401X c.1202G>A or c.1203G>A p.Trp401X
W496X c.1487G>A p.Trp496X
W57G c.169T>G p.Trp57Gly
W57X c.170G>A or c.171G>A p.Trp57X
W846X c.2537G>A or c.2538G>A p.Trp846X
W882X c.2645G>A p.Trp882X
Y1092X c.3276C>A or c.3276C>G p.Tyr1092X
Y122X c.366T>A p.Tyr122X
Y161D c.481T>G p.Tyr161Asp
Y275X c.825C>G p.Tyr275X
Y563D c.1687T>G p.Tyr563Asp
Y563N c.1687T>A p.Tyr563Asn
Y569D c.1705T>G p.Tyr569Asp
Y849X c.2547C>A p.Tyr849X
Y913X c.2739T>A p.Tyr913X

 

Dane źródłowe:

  • Baza CFTR2 https://cftr2.org/
  • Dane Fundacji Oddech Życia

Zostaw odpowiedź

Twoj adres e-mail nie bedzie opublikowany.